Published SSR Primer Information

This analysis estimated the origin of amplicon for previously published SSR primer pairs (Grauke, Iqbal et al. 2003, Grauke, Klein et al. 2015) in the Oaxaca-v1.1 reference sequences (HudsonAlpha Genome Sequencing Center). In-silico detection of binding sites determined in CLC v2.02 with default settings except a max fragment length of 750 bp and primer concentration of 500 nM. Ambiguous amplicon detection results were clarified with BLAST. Mismatches between the 'Oaxaca' sequence and the primer sequence indicated with lowercase letters.

Primer	Publication source	Chr	Region	Fwd. sequence	Rev. sequence	Approximate Fragment length	Fwd. primer Melt. temp.	Rev. primer Melt. temp.
A05	Grauke et al., 2003	Chr08	21889556..21889712	GTCAATCATCCCAATCAAA	AAAGGTGTCTGTGGAAAGG	157	52.05	57.17
Ca10	Grauke et al., 2003	Chr08	27659550..27659664	GCAAATCAACCCTGTAGCATA	GCTCAGACAtGCAAACGTACC	115	56.52	60.02
Cin13	Grauke et al., 2003	Chr03	3867534..3867669	CAAAAAGCATCAAAGCCATC	ACAAATTCCTCACTCCGGAG	136	56.62	59.3
Cin20	Grauke et al., 2003	Chr06	27631523..27631662	GCTGGTACACTTCTGCTTCTTCT	GTTCACGACAGATGAGTGCGA	140	61.21	61.7
Cin22	Grauke et al., 2003	Chr02	16614491..16614604	CCAACAAGGGAAGCCAACTT	gGtTaTGAAATTTGATATTACTTTTGG	114	61.19	54.68
Cin23	Grauke et al., 2003	Chr01	28711363..28711447	GGACCATAAGAGTTTTGACCCTT	GGAGTTGTGgAAGCAGTGGA	85	59.54	61.16
Cin4	Grauke et al., 2003	Chr05	24095582..24095675	GGCATCAGAGAAGGCTCCT	CTCACCCGTCTCTAGGGCTA	94	59.25	61.05
Ga38	Grauke et al., 2003	Chr07	39947745..39947860	CCAATGTTTCTTCGAAAGGACA	GTAAAGCCTACAACCTACAACAGTCTATG	116	58.09	61.64
Ga39	Grauke et al., 2003	Chr05	20524803..20524893	TGTAAATGCGTGCTATTGCTGAT	GAATAGACAAAGAAACGAAACTCATTGA	91	59.06	59.08
Ga41	Grauke et al., 2003	Chr01	11889572..11889798	GGCGAAACCGTAAACCTG	AACACCAGCACCCAAATC	227	57.1	57.64
Wga118	Grauke et al., 2015	Chr15	34247765..34247930	TGTGCTCTGATCTGCCTCC	GGGTGGGTGAAAAGTAGCAA	166	59.26	59.76
Wga242	Grauke et al., 2015	Chr01	56649185..56649415	AAGCTCCCCTCCACCATC	TGCATGCTTCATGGCTCTAG	231	60.59	58.09
Wga321	Grauke et al., 2015	Chr10	8717306..8717541	TCCAATCGAAACTCCAAAGG	TGTCCAAAGAcGATGATGGA	236	56.47	57.41
Wga4	Grauke et al., 2015	Chr10	1449486..1449708	CCATTGcTCTGTGATTGGG	cAtcaAAGCAAGCAATGGG	223	57.67	56.81

Works Cited

Grauke, L. J., M. J. Iqbal, A. S. Reddy and T. E. Thompson (2003). "Developing microsatellite DNA markers in pecan." Journal of the American Society for Horticultural Science 128(3): 374-380.

Grauke, L. J., R. Klein, M. A. Grusak and P. Klein (2015). "The forest and the trees: applications for molecular markers in the repository and pecan breeding program." Acta Horticulturae 1070: 109-126.

This work is supported by the Specialty Crop Research Initiative Coordinated Agricultural Project no. 2022-51181-38332, from the U.S. Department of Agriculture’s National Institute of Food and Agriculture.

Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and should not be construed to represent any official USDA or U.S. Government determination or policy.